Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1b07
Contig Information
Length 727 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1b07   
Homology (BLAST) Top Hit hypothetical protein OsI_24244 [Oryza sativa Indica Group]
Score 1107
Evalue 3.5906e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whsc1b07
AGCCTCCCCCGCGCCGACCTCAAGCAGGTCTGGGCCATCGCCGACTCCAAGCGGCTGGGGTACCTCGGCTTCGGCGAGTTCATCACCGCCATGCAGCTCG
TCTCTCTGGCGCAAGCGGGGAATGAGATATCCCAGGACAGCCTTCAGCGGGAAGATCTAATCAGCTTCAATCCCCCAGTGATGGAGGGTTTGGATGCTCT
GCTTGCGAAATCCAAGCATTTGGCAAAGAGGGTCGATCAGGATATGGATGGATTTCCTCAGGCACAAGGACCTTCTACTAACCATTGGTTCAACTCTAAG
TCATCCAAGAAGATACCCCTGACTGCTGTTACTTCTGTCATTGATGGATTAAAAAGACTATACATTGAAAAATTGAAGCCTTTGGAAGTTACATACAAAT
TCAATGATTTTGTGTCCCCGTTACTGACAAACAGTGATTTTGATGCAAAGCCAATGGTTATGCTCTTAGGTCAATATTCTACAGGGAAAACTACTTTCAT
CAAACATCTGCTAAAAACAAGCTATCCAGGTGCCCATATTGGACCAGAGCCGACAACCGACAGATTTGTTGTTGTCATGTCAGGACCTGATGAAAGAACT
ATTCCCGGGAATACTTTAGCTGTTCAAGCAGATATGCCTTTCAGTGGTCTCACAACATTTGGGACTTCGTTTTTATCAAAGTTCGAATGTTCTCNNATGC
CACATCCACTACTAANANCATATCACG
page-top