Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1a21
Contig Information
Length 529 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1a21   
Homology (BLAST) Top Hit hypothetical protein OsJ_026823 [Oryza sativa (japonica cultivar-group)]
Score 413
Evalue 4.83065e-39
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>whsc1a21
GAGCTGGTTACGCGAGGAAGAAACAACATGTGTTATCTTTCAGTCGGTCGGTCGGTCGTGTTCGTCGGTGATGCAGCAATCCCTTCTGTCATGGATTGGG
ATGTGATGTTGGAATCCTATGTTTGAACTCAGTTTAAATGGATGAAGAAAATGCAAGTGATAGCTGCGAAATAAAAACCTCGTGCCGAATTCGGCACGAG
GGGAAACTTGGAAAGGACCCTGATGATTTATATTATTCTGCTCCCAAGGCTCATCCAGTCAGTTCTGAGCCTCGGCGAATTAGCATTGACATTGAACAAG
CTCAAGCTCTCATCTGTAAACTTGATTCTGAGAAGGGTATTGAGAATAATGTTCTATCTAGTAGTGATGATGACAAAGCAGGCAGCGGATCACATGGTTC
AATGGGCCCAATTGTAATAATACGGGGTGCATCTACTGTGAAGGGTCTTGAAGGTGTTGAGTTGCTGGACACTCTTGTCACTTATTTGTGGCGTATCCAT
GGTGTGGATTATTATGGCATGTCTGANAC
page-top