Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc9o16
Contig Information
Length 135 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc9o16   
Homology (BLAST) Top Hit eukaryotic translation initiation factor 5A1 [Triticum aestivum] >gi|78191541|gb|ABB29983.1| translation initiation factor 5A [Dasypyrum breviaristatum] >gi|78191543|gb|ABB29984.1| translation initiation factor 5A [Secale cereale] >gi|78191547|gb|ABB29986.1| translation initiation factor 5A [Aegilops tauschii] (no hit)
Score 792
Evalue 2.8837e-82
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc9o16
CGCCGCCTCCTGTGCGATGAGGAGGANAAGCAGGACCAAAACCACCTGCNTCGCCACCTTCTTGGTCCACATTGTGAACGGCCGGGCTGGGAGCNACCTA
AACTCTGCTTGCGCTACGTACTGGCTTTGCTACTG
page-top