Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig71
Contig Information
Length 647 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl4f19    rwhfl4f19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative membrane protein [Triticum aestivum]
Score 757
Evalue 1.07949e-78
Total Hit Count 59
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig71
gtACGACCATTCGCATCGCAGCACACCAGCTTAGACATGGCCGCCGCCACCTCCACCGTCTCCGGCCTCGCCGGCGCCGCGCTCACCCGCCGGCCAGCCT
TCTCTACCAGCTTCACGAGTGGTGCCCGGGTGTCGGCGAGGAACCCGCTGATGACGAGGAACCTGGAGAGGAACGGCAGGATCACCTGCATGACGTTCCC
GCGGGACTGGCTGCGGAGGGACCTGAACGTGATCGGGTTCGGGCTGATTGGGTGGCTGGCACCGTCGAGCATCCCACTGATCAACGGCAACAGCTTGACG
GGGCTCTTCTTCTCCAGCATCGGCGAGGAGCTCGCCCACTTCCCGTCGCCCCCGGCTCTCCAGTCGCAGTTCTGGCTGTGGTTGGTGACGTGGCACCTGG
GTCTGTTCATCGCGCTCACCTTCGGCcagatCGGGTTCAAGGGcaggaccgaggactacttccagaagtagcgaattaactagctttggttcgtgcatgt
gcgtcgtccttgggctgctcaagggctgcttctgcgcatgcgtgttcaatgtaaaatctgccatgccttttggttttgtgcatgcgtgtggcttcgcaag
ccgtgtgattgctgtttgttaattacctcttccatgnaagcacaaaa
page-top