Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1319
Contig Information
Length 601 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10a09    rwhdp10a09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative membrane-bound protease [Synechococcus sp. JA-3-3Ab] >gi|86554031|gb|ABC98989.1| putative membrane-bound protease [Synechococcus sp. JA-3-3Ab]
Score 80
Evalue 2.88868
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1319
CCTCATCGAGTCCCGACCGAGGCCGAGGGGAACGGGACCGCATCGATTCCACTCCGGAATCAAGCCGCAGAGAGGGGCAGCCGGTTCCATCCAGTGAAGA
CCGCCGGGGTGCGTCGGTTAACCTGAGGTCAGGGATGGGATCGAGTCCATCCAGTCGATCGCAGCGACCGGAGGAGCGGGATCCAGGTCAAGCTGAGTCC
ATCCGGTCGATCCCAGCGACCGGAGGAGCGGGATCCGCGTCGAGCCGATCCAATCCAGCGCGTTGTAGAGGTGTGCTACGGAGTCAAGGTGCGGGGGAGG
GAGATAATGGCAGACGCCTCGCGTACTGGTCAGGAAGACCGTCTTACTTTGATCCTTGGGCAGTGTGACTGATCGGTAGATCAACATCAAAGTTTTGATG
ATCTATGATTGTTTACGTGTTCAAGGTCTTGTGTAGTTGTCTGCTTGATCTGGTAGTATGACACATAAAATATTAAGGCATGTGAAATGTTTGATAGTCA
CTTGAAGCTGATTTTGCGTAAAGTCAAGAGTGACCTTTTGTTTTATGAGTTTTCAAAGGANTCTGTTATAATTTATATAATTATTATTTTTAAAAAAAAA
A
page-top