Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1295
Contig Information
Length 450 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10c05    rwhdp10c05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit endo-1,4-beta-glucanase [Triticum aestivum]
Score 319
Evalue 3.08273e-28
Total Hit Count 418
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1295
TAATATCCTCGTTGGAGCAATGGTTGCTGGCCCTGACAAGCATGATGGCTTCAAGGATATCCGCACAAATTACAATTACACAGAGCCTACTCTTGCAGCA
AATGCTGGCCTGGTTGCAGCATTGATTTCTCTAGCTGACATCGATACCGGCAGATATTCAATTGATAAGAACACCATCTTCTCAGCAGTTCCCCCAATGT
TCCCGACACCCCCACCACCACCATCAGCTTGGAAACCATGAAGAGTCAGATCCCTGAACATTTCATAAGCATCAAATGGAGGGAGCAACAGATGGTTGTT
TGGTATATACAGCGAAGGCCACGAACAGAAAGCAGACAACATAAGCTTACAGAGTTTCTACTTCTGTATCGGTATGACGGATCAGTATAAATCATCTGTG
AACCATGGACTGGAAGTTGTGTGCGATTTGTGAAACTAATTTTTGAGGTC
page-top