Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig70
Contig Information
Length 826 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl20k10    rwhfl20k10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit rCG63148 [Rattus norvegicus]
Score 104
Evalue 0.00910894
Total Hit Count 57
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig70
actagagagagcgaagcgagtgtctcccgaagcatcatccttcctggcgaagcaagcgacgcctgccgcgccttcgccttctgccgccgcagcgactggg
ccgacgatctccgcgcgcctcgccctctcgccggcgacatgactcgctcctttcccaacatgtaccggctccgagccagggacaagattaagatggcaat
caagcgtgggttcagcgatgaggatgaggaggaagtgacacagatgtcaggcccagtggacttaaaggaggccacccacgcagacaagatcacaaaggaa
gcttgggctaaggttatcgtGCACAGGAAAGCgtctgCCCTGACAGGTGCCCCGCGGATCGCGACAGGCCCCACCCCTGCCCTGGAGAACGCCACAGGCC
CGACCCCTACCTCGGAGACTGCCCCGACCCTCGCCCTGGCCCGAGCCATCCACTAAatctgGCGAAAGGACTGCTGTACAAATGGGCAATTGGCACAAGG
CAAAGATTTCAGGGGAATGTTTGCATCAACAGgttttttttttcagttcctcttgtttttagttcccttcctaatggtgatcagtcacaaaccttaaaat
gtagctgagtttgtgccttgaaaccggctgaagggtactggtaaatggtaaggggagaagctttcccgtggtatgcgaaccaagtcttgtggttacgatg
gatgctttaccttgttctgcaatgcggaagcatgtatgtgttcactctgaggtgtttgtctttgtcgtggtggtggcatatgatttcgcgttcatgtgag
atgatcgtatgttcgtctggtgtcta
page-top