Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig7
Contig Information
Length 655 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl6c01    rwhfl6c01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0760800 [Oryza sativa (japonica cultivar-group)] >gi|14488366|gb|AAK63933.1|AC084282_14 putative protein of gibberellin-stimulated transcript [Oryza sativa (japonica cultivar-group)] >gi|55167448|dbj|BAD67542.1| Gibberellin stimulated transcript related protein 1 [Oryza sativa Japonica Group] >gi|108711207|gb|ABF99002.1| Gibberellin-regulated protein 2 precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549819|dbj|BAF13262.1| Os03g0760800 [Oryza sativa (japonica cultivar-group)] >gi|125545799|gb|EAY91938.1| hypothetical protein OsI_13625 [Oryza sativa Indica Group] >gi|125587999|gb|EAZ28663.1| hypothetical protein OsJ_012146 [Oryza sativa (japonica cultivar-group)] >gi|215768197|dbj|BAH00426.1| unnamed protein product [Oryza sativa Japonica Group]
Score 378
Evalue 9.63333e-35
Total Hit Count 240
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig7
accaactc*actcctcCAGCCTCCTCCTATCGTCAAGCTCACACCAACCAGCAGGAGGGCTCTGCCAGAGCCAAGCAACCAAGAACACCACGATGAAGAA
GCTTCGCACCACCACTCTGGCTCTCCTTCTCCTCCTCGTCTTCCTAGCAGCCTCGTCCCTCCGTGCCGCCATGGCTGGGTCAGCGTTCTGCGACGGCAAG
TGCGGGGTGAGGTGCTCCAAGGCGGGGCGGCACGACGACTGCCTCAAGTACTGCGGGATATGCTGCGCCGAGTGCAACTGCGTGCCGTCGGGGACCGCCG
GCAACAAGGACGAGTGCCCCTGCTACCGCGACAAGACCACCGGCCACGGCGCGCGCAAGAGGCCCAAGTGCCCATGATCCGCCACCACTCTCCAGGCATC
GATCCTCCACCGCCCATGGCGTCTACaca*ccaTATGCCTGAGCTTCATGCATCCCTATCTATCATGTCGTACCATGTCGCGGATCACTACTAGTATATC
TTATAAGCGTGTAAACCATGATCTGtagcgTCTGGTGCATGAtccgattccgactatatgttgatgtgcataatgctggcctagctactggtatgccggt
aaaaatgtcgctgtgctgtaataatgaaccatgacgcatcagtaaagttgtccag
page-top