Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd1k16
Contig Information
Length 678 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd1k16   
Homology (BLAST) Top Hit calcium-dependent protein kinase [Triticum aestivum] >gi|164472652|gb|ABY59008.1| calcium-dependent protein kinase [Triticum aestivum]
Score 1052
Evalue 7.36571e-113
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whrd1k16
AACACCTCCTAGTTACAACAATGCTCAGCCACCACCACAAGCTGAGGTGAGGTACACACCGCCAGCGATGAACCCTCCTGTCGTCCCACCTGTGGTTGCC
CCCTCAAAGCCCATGCCGGACACGATTCTCGGCAAGCAGTACGAGGATGTGCGCTCTGTCTACTCCCTTGGCAAGGAACTTGGTAGGGGGCAGTTCGGGG
TGACGTACCTTTGCACTGAGATTAGCACTGGCAGGCAGTATGCTTGCAAGTCCATATCCAAGCGCAAGCTCGTGAGTAAGGCCGACAAGGAGGATATCCG
CAGGGAGATCCAGATCATGCAGCACCTATCTGGGCAGCCGAACATAGTGGAGTTCTGTGGAGCATATGAGGACAAGGGCAGCGTGCATGTTGTGATGGAG
CTCTGTGCAGGCGGGGAGCTGTTTGATCGGATTATTGCCAAGGGGCACTACTCAGAGCGTGCAGCTGCTACAATCTGCAGAGGAGTTGTGAATGTTGTCA
ATGTTTGCCATTTCATGGGAGTGATGCACCGCGATCTGAAGCCAGAGAACTTCTTGCTCGCGACCAAGGATGAGAATGCTGTGCTCAAGGCCACTGATTT
CGGGCTTTCGGTCTTCATTGAAGAAGGAAAAATGTATAGGGACATCGTTGGAAGTGCTTATTATGTTGCTCCTGAAGT
page-top