Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1255
Contig Information
Length 321 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10a10    rwhdp10a10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera] >gi|157359873|emb|CAO68602.1| unnamed protein product [Vitis vinifera]
Score 241
Evalue 3.43806e-19
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1255
GCGCCACATCCAGCTGGCGGTGCGCAACGACGAGGAGCTGAGCCGTCTGCTGGGCTCGGTCACCATCGCCGCCGGCGGGGTGCTGCCCAGCATCCACACC
ACGCTGCTCCCCAAGAAGGCCGGCAAGGGCAAGGGCGACATCGGCTCCGCTTCCCAGGAGTTTTAGATTAGATTAGTATGGTCCTTGTGAATGTTTGGGT
TGGTGTGTCATCGATGTTGGTGGTGGATCTGGTTGGAATGGATTGCAGCTCGCAATCTTGTTCTTGTTGTTACTGCCTGTGATTTGTCAGTGCTAATGTG
CGTTCTGTCCGAAAAAAAAAA
page-top