Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd10g08
Contig Information
Length 707 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd10g08   
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 160
Evalue 2.17672e-09
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>whrd10g08
TTGGGGAGGATGTGAGGCGGGCTCTTCGGTGGCCGCGAGAACTACGACAAGCGCCTGCACTACCTGTCCAAGGAGGAGGTCGTCGTGCACGCGCGGATGC
GCCGCCGGGCCCAGTTCTCCTGTCGCACCTTCCGCAACATCATCGTCCTCTCCATCATCGCTGAGGAACATTATTTATCAAGTTTTGGATCAGATGCGGG
GATTTCTCCTAAACTCCACCGCCTCAAGATGTCGTAGTTGGTGTTGTCCGTGCTATATTCTGCAGTGCGCTCGACGGCTGCCTCCTCCTCTGCAGCGGCA
AGCCTTGGACTAGGTCGCAGCACCAGAAGCAGACGAAGCCTTGGACTATTCTGCACTGGTCCAGGCGGCAATCGTCCACAAGAAGAGGGGAAGTCATGGC
AGCCGGGTCCTCATCTGTGACCGCTCCCTGACCACCATATTCTGCTGCATTTGTTCCTTGTGAGGGGGATAGTATATTATCCTCAAATAATAGTGGAGTG
TTCTAAAGAAAGGGCTAGCATAGGAGATGCAACGGGGTAGCATATTATCCGAGGAGTGTTCTAAAGTTGCCAAACATATCTCCCCCGAATCTTTTTGCGT
TTGGATCCTTTTGCATCTCCTATTCCTCTTTTGGTTTCTTCTTCTTGCCTCTATCATTCCTTTGGATGTTTCTTGGGCTATTTGGATGTTTCTTGGGGCT
ATTTGGA
page-top