Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd10g02
Contig Information
Length 725 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd10g02   
Homology (BLAST) Top Hit Os02g0165100 [Oryza sativa (japonica cultivar-group)] >gi|49388058|dbj|BAD25172.1| putative receptor protein kinase PERK [Oryza sativa Japonica Group] >gi|49388415|dbj|BAD25548.1| putative receptor protein kinase PERK [Oryza sativa Japonica Group] >gi|113535526|dbj|BAF07909.1| Os02g0165100 [Oryza sativa (japonica cultivar-group)] >gi|215694876|dbj|BAG90067.1| unnamed protein product [Oryza sativa Japonica Group]
Score 523
Evalue 1.86169e-51
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whrd10g02
GTCCAGGGCTGCGCTCGTGCTCGGGAACCCTCGCGGCCGCTGACGACTCGCCGGGTCTGCTTGCTTGAGGAGCGGTGCCTGTCTGCCTGCGCGCGCTGCG
AGGGTGGCGGTAACTTCTTCTGCGGTCTCGGATCGCGTCCGATTCGAGTTTCCCGGGCGGCTGTTCCCCGGGGCTGGAAGGTGGATTAGGCTGCGGTTGG
TCAGGATATGATGGCAGCTGTTTAAGGTTGGTGAAATGTCTGTGCGGATATCATAAGTGCAAACATATTTATTGAACTGACAACGGCAAGGCAGACATAT
TTTGAGAATATAAGTAATGGGTTGTTCTCCTTTCTTCTGCTATAAAAGTGGGGCAACACGCCAGCAAATTTCTACGCATACTGAAGACCTCCCTGGTGAT
ATTAATACAATAAGATACACTTATAAGGAGCTAGCAAGGGCAACAGAAAATTTTAACCCATCCAACAAGATTGGTGAGGGGGGTTTTGGATCTGTATATA
AGGGGCGGCTAAGGAATGGAAAACTTATTGCTGTCAAGGTGTTATCTGTAGAATCAAGACAAGGACTAAAGGAGTTTCTGAATGAACTGATGTCAATTTC
CAACATATCTCATGGCAATCTTGTCAGCCTTTATGGCTATTGTGTGGAAGGAAACCANAGGATCCTTGTCTACAATTACCTTGAGAATAATANCCTTGCA
CAAACACTTCTAGGTTCTGGCCGCA
page-top