Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd10f21
Contig Information
Length 733 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd10f21   
Homology (BLAST) Top Hit hypothetical protein OsI_02645 [Oryza sativa Indica Group]
Score 210
Evalue 3.76719e-15
Total Hit Count 85
Registered year 2003
Contig Sequence     [ Download ]
>whrd10f21
AGAGCTTTTTACGCGTCTCCGCCAACGCCGCAGCCGACGAAACCCTAGCATCGCGATGTTGTCGTCGAAGGAGCCCCTGGGTCCTGGACATGCCTTTCCC
GGCGACTGCTATCCCAGCCATCTGCCCAGCTTCGAAATCCCCACAGATCTTTTTGGTCCCTTTCCCCGGCATGTTCATGAGACTCGCGAGGAGGCCCCCA
TCGATGTGTTTAGATTCGAAATCGCCCCAGATCTATTCGGTTCTACCCACCATCGTCTCCTTGATGCGTTCGAGGAGGAGGAGGAGGAGGAGGTGGTGGT
GGTGTTGGCGGAGAAGAAAGAGAGAGGGTTCCTCGAGAGCGAATCAGAGTCTGAATCTGAGTTGCCTAGCTGGGACGACATTCTCGTGGGCGCTGGTGTT
GAACCTGTTGATGGCGTCAACTTGTCCGACTTGATGGATTACGATCCGCTGGCAGTGGATGCCGACAACGAGGAGACAAACTGCCCAGGGAAGAAATTTC
CCGAGGCAACAGCAGCGAAAGTAGACGATATATGGAGTAGGATTTACACCAGACGCAACATCGAGTACCAGAAGAAGTGTGAGGAGATTGAAGCAAGTGA
AGATGAGAATGCCACATTTCCTTCTTATCCTCTCAAAATACTCCCTGAGGCAACAGGTCTATGTGTCTTGAGGGGCTTTTGCCACCACCGTGAATATAAA
ACCCATGATACTTCCACTACTANATCAAGTCTT
page-top