Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd10f17
Contig Information
Length 668 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd10f17   
Homology (BLAST) Top Hit hypothetical protein OsJ_021058 [Oryza sativa (japonica cultivar-group)]
Score 698
Evalue 7.97856e-72
Total Hit Count 430
Registered year 2003
Contig Sequence     [ Download ]
>whrd10f17
GCGGCGACAGGAGCACCTGGTCGACCTTGTAGCCATCGAGGGCAAGGTCGCGCCGTCCTCATTGCCGGTGACACTCCCCGGCGACCAGGAGGCGTGGAGT
GTGCAGCTGTTCCGGTCCATCGACAACATGGCCACCGTGGGCTTCCCCGACTCCATGGAGGCTGCCTACGAGGCCGGCCTCGTCCAGGACAAGCACCATG
TGTTCGAGAGGAGCATCCAGGACGCCTACATCCACGCAATACGTGCCGCAAAGAACTTCATCTACATCGAGAACCAGTACTTCATCGGCAGTTCCTTCCA
GTGGAAGTCCGGCGTCGGCATAGATCCGGCGGCAGTCCAGGCGAATCACACGATCCCTAGAGAGCTCTCGCTCAAGATCGTGAGGAAGATCGAGGCCGGT
GAGCGCTTCGCGGTCTACGTCGTGGTGCCCATGTGGTCGGAAGGCTACCCTACGCATATGTACAGGCAGGCGATGCTGGACAACCAGAGGAGGACCATGT
CCATGATGTACAACGACATCGCCGCTGCGCTGCAGGCCAAGAACATAGACGCTGATCCCAGGGACTACCTTACCTTCTTCTGCTTAGGGAACCGCGAGGC
GAGGAACCCAGAGGGCGGCGAATACCAGCCTGCGAAAATCCCAAAGGACGGGACGGACTATGCCAAGG
page-top