Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd10a21
Contig Information
Length 699 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd10a21   
Homology (BLAST) Top Hit Os05g0524400 [Oryza sativa (japonica cultivar-group)] >gi|52353488|gb|AAU44054.1| putative diphosphate-fructose-6-phosphate 1-phosphotransferase [Oryza sativa (japonica cultivar-group)] >gi|55168177|gb|AAV44044.1| putative diphosphate-fructose-6-phosphate 1-phosphotransferase [Oryza sativa (japonica cultivar-group)] >gi|113579641|dbj|BAF18004.1| Os05g0524400 [Oryza sativa (japonica cultivar-group)] >gi|215706321|dbj|BAG93177.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1151
Evalue 2.60827e-124
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whrd10a21
CCAGCATATTCAACTGTCAAGCAGTATTTTGTCAATGAAGATGACACCGTACCACAAAAGGTTGTTGTTCAAAAGAATAGCCGCCGGGGGGTTCACTTCC
GTCGTGCTGGACCCCGTCAGAGGGTTAATTTTGAGTCAGATGAAGTGAAAGCATGCATTGTAAGTTGTGGAGGCCTTTGCCCTGGGCTCAACACTGTTAT
CAGGGAGCTCGTGTGTGGCTTGGCGCACATGTACAATGTCAACAACATCTTTGGAATACAGAATGGATACAAGGGCTTCTATTCTAGCAATTATGTTGCT
ATTACACCAAAGACAGTCAATGACATCCACAAAAGGGGTGGTACAGTCCTTGGAACATCACGAGGTGGTCATGATACAAAAAAGATTGTTGACAACATTC
AGGATCGGGGAATTAATCAGGTGTATATCATTGGAGGAGATGGAACTCAGAAAGGAGCATATGAGATCTACAAGGAAATCCGGAAGCGTGGTCTAAAAGT
TGCTGTGGCAGGGGTTCCCAAGACAATAGACAATGACATAGCGATTATTGACAAGTCCTTTGGTTTTGATTCGGCCGTCGAAGAGGCTCAACGTGCCATT
AATTCAGCTCATGTGGAAGCTTGCAGTGCTGAGAATGGAATAGGATTGGTAAAACTGATGGGTCGTTATAGTGGGTTCATTGCGATGTATGCTACTCTT
page-top