Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd10f01
Contig Information
Length 685 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd10f01   
Homology (BLAST) Top Hit hypothetical protein OsJ_020002 [Oryza sativa (japonica cultivar-group)]
Score 263
Evalue 2.3469e-21
Total Hit Count 140
Registered year 2003
Contig Sequence     [ Download ]
>whrd10f01
TCTTGCCCCCACAGAAGCTGATGTCAGTGATCTGCAAAGTGAGGCTGCTGCTATTGATGTGACTAGTCCTAAGCAAGATACTATGGTAGTTGAAGCACTG
CACACTAATTCCGGAGGTTCTGCTAGTCATCTGCCTGCTGCTTTACAATCAACGGACTCAAACCAGCATGCAGAACGGAAAGGAAGTTCAGAGAACAGTG
GCTCTAAATTTTTTGCATCTGGGAAGAAAACAGAGGAAATGGAAGGAACTTTGGATAAGAATACGGATAACAATCTTATTCAGGCAAATGCCGATATAGC
TTTAGGAAGACATTCTCCTTCAGAGGACAAAAGAGAGGACAGTTGTGCCCATGTAGTTGATGGTGGCCTGTTGGGAAGCAAACAAACTCTTCTTGAAGTC
GTTTCTGCTGTAAACACTGATGGCTCTGAGGAAGCACTCAATGCTTCGTCTACCCATTCGAATAAAGATGCCACCTCGGNTTGTGAAGTAACAAAGGATC
CTGAGAGCCATGTAAGAGTGTCTGTACTGGCCTCTGCTGCTATGAACGCTCGTGATGACTGTGAGGAAGTTCACAATGTTCCATCCACCCATTCTGATNN
AGGGGGCAGCATGGTAGAAGTTGATGCGTCTAGAGATGATGCTACCTCTATTTGCGAAGTATGCAAGGATCCTGANAGTAATGTA
page-top