Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd10a17
Contig Information
Length 710 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd10a17   
Homology (BLAST) Top Hit Os02g0467000 [Oryza sativa (japonica cultivar-group)] >gi|47497514|dbj|BAD19567.1| putative cinnamate 4-hydroxylase [Oryza sativa Japonica Group] >gi|113536345|dbj|BAF08728.1| Os02g0467000 [Oryza sativa (japonica cultivar-group)] >gi|125582045|gb|EAZ22976.1| hypothetical protein OsJ_006459 [Oryza sativa (japonica cultivar-group)]
Score 958
Evalue 4.40403e-117
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whrd10a17
AGCTCATGCTCTACAACATCATGTACCGCATGATGTTCGACGCCCGGTTCGAGTCCGTGGACGACCCAATGTTCGTGGAGGCCACCAAGTTCAACTCGGA
GCGCAGCCGCCTGGCGCAGAGCTTCGACTACAACTACGGCGACTTCATCCCCATCCTCAGGCCCTTCCTGCGTGGCTACCTCAACAAGTGCAGGGACCTG
CAGACCAGGAGGCTGGCCTTCTTCAACGCCAACTACGTCGAGAAGAGAAGGAAGGTGATGGACACACCAGGAGACAAAAACAAGCTCCGATGCGCGATCG
ACCACATCCTCGCAGCAGAGAAGAGCGGCGAGATCACGCCGGAGAACGTGATCTACATCGTGGAGAACATCAACGTTGCCGCCATCGAGACGACGCTATG
GTCCATCGAATGGGCGCTCGCCGAGGTGGTGAACCACCCGGAAGTGCAGCGCAAGGTCCGCGGCGAGATCAGGGACGTGCTCGGCGACGACGAGCCCATC
ACCGAGTCCAATATCAGCAAGCTGCCGTACCTGCAGGCCGTGATCAAGGAGACGCTGCGGCTGCACTCCCCGATCCCGCTCCTCGTCCCCCACATGAACC
TTGGAGGAGGCCAGCCTCGGCGGCTACACCATTCCCAAGGGCTCCAAGGTGGTGGTCAACGCCTGGTGGCTGGCCAACAACCCGGAGCTATGGGAGAANC
CGGAGNAATT
page-top