Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd10c12
Contig Information
Length 749 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd10c12   
Homology (BLAST) Top Hit 26S proteasome non-ATPase regulatory subunit 4 [Zea mays]
Score 912
Evalue 1.54004e-96
Total Hit Count 240
Registered year 2003
Contig Sequence     [ Download ]
>whrd10c12
ACCCGAACCCAACCCTCGACCGCAGCGACTCACAGCGGCGCAACCATGGTGCTCGAGTCGACGATGATCTGCATAGACAACTCGGAGTGGATGCGGAACG
GCGACTACTCGCCGTCCCGCTTCCAGGCGCAGGCCGACGCCGTCAACCTCATCTGCGGCGCCAAGACCCAGTCGAACCCGGAGAATACGGTGGGCGTCAT
GACGATGGCCGGCAAGGGCGTGCGCGTGCTTGTCACCCCCACCAGCGACCTCGGCAAGATCCTCGCCTGTATGCATGGGCTGGAAGTTGGAGCTGAAGCA
AACTTGGCCGCGGCTATTCAGGTTGCTCAGCTGGCGCTAAAGCATCGCCAGAATAAGAGGCAACAGCAGAGAATTATTGTTTTCATTGGAAGCCCTGTGA
CATACGACAAGAAGGTCTTGGAGACAATAGGGAAGAAGCTGAAGAAGAATAATGTTGCCCTTGACGTTGTTGATTTTGGTGAAACTGATGATGAAAAGCC
TGAGAAACTGGAAGCGCTGATCGCTGCTGTGAACAGCAGTGATAGCAGCCACATCGTCCATGTCCCTCCGGGTGACCATGCCCTTTCTGATGTTCTTATA
AGCACTCCTATCTTTACTGGCGAAGAAGGTGGAAGTGGCTTTGCTGCTTCTGCAGCAGCTGCTGCAGCCACCGGAGCTACTGGATATGATTTTGGCGTGG
ACCCAAATGTGGACCCAGAGTTGGCACTTGCCCTACGGTTGTCTATGGA
page-top