Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd10d06
Contig Information
Length 714 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd10d06   
Homology (BLAST) Top Hit hypothetical protein OsJ_002025 [Oryza sativa (japonica cultivar-group)]
Score 585
Evalue 1.17108e-58
Total Hit Count 125
Registered year 2003
Contig Sequence     [ Download ]
>whrd10d06
AATTCTCTTGCTATTGGCGAGATACATGTGGAAAAAGAACTGCAAAACATGTTTGCTAAAAAAAATGGCAAAATATGTCGATGTTCATCACATAAGCCAT
GCCACGAAAGGTGATTACAGATAGCCATCAAGCACTTGCAGGTTAGCATATACATCCTGGGAAATCCCGATCAATTAGAAATGGCATCAAATAAATACAT
GATACAAAATGCAGTGTAGCATAATAAAATATCAGACGAGCAGAGATTACTTCACAAGCGGTGAAGTCAGAATGTATATGTCGATCTCATCCAACGTCGG
GCAGTCGCGCAGCGTCAAGCTGTGTTCATTTGTCAGATGCAAGAGACAAATGAAATAGAGGTGTGGCGAGATTTCAGTCGTTGAAACATCTCTGTTACTG
CATGGAAGATCATGCAGTACCTTCGTCAGGCACAGAGACGGTTCTATGCCATCTCTTTCCAGATCAGCAGTCTTAGCAGATGTATGAATGTGATTCCAGA
GCACTTCCTTTAAGGCATGAACATCGACTTGTTTCGATACCTTGTCATATTGTACATCGATCTTATTGACCTGTCTTGGTTTGGCAATAAGATTTACTGG
CTCTTCCACATCACTAGCCGCATCCCCTTCATCAACATGATCATTGCCCAGGTCATCATCGTCCCAATGTCTGGATGGCATAAAGTCATCGCTGTTGCCC
CTTGAATCATCAAG
page-top