Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd10b23
Contig Information
Length 131 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd10b23   
Homology (BLAST) Top Hit hypothetical protein OsI_01634 [Oryza sativa Indica Group]
Score 201
Evalue 1.47068e-14
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>whrd10b23
TATGCTTACCTGGANAAGACAGCTATGAAGTACATGGAGAGTCTTGGTCATGAAGCACGGANACACAGTACCATCGTTGACATTCTTTGTGCTGGAACAT
GCCCTGTGAGGGTTCCTGTCCTACAGCCACT
page-top