Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd10b22
Contig Information
Length 699 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd10b22   
Homology (BLAST) Top Hit Os11g0552600 [Oryza sativa (japonica cultivar-group)] >gi|113645306|dbj|BAF28447.1| Os11g0552600 [Oryza sativa (japonica cultivar-group)]
Score 278
Evalue 4.38742e-23
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>whrd10b22
CTCCAGGCCGCTGCAGGTGCATGCGTCCGCTGGATCAGGAGCGGCTGCCCGCATCCGCTGCTGCAGGATCGTCTGCCCGCTCGCTCCAGGGTCCTCGGCT
GGCCTCGCGTCCCGGATCTCTGCTCCTCTGCCCACGCGCCTGCGGCTTGCCCACCTGATCGTTCCAGCCGCTCCCACCTGCATGCACTTGCCTCCCGTTG
TTAGCTGCTACATGCTGCTTGCTTGCTAANGTGTTGCGTGTACGAGTATCTCTTAGCATCTGTTGCGCGCTCTTCATGCCGCTCCTTGTCAGCAACTCAT
CTGCACGGCACCATAACTTTTCTTCGGCTGCCATTACATCAGTCTGATTCTAACAGATGCTGCTCTGCTGAAGAGGCAAAAACTGGAAATAGAGGAACTT
CGCAAAAAGCTGCAGGGTTCCCATTCTGAAGTCTTGGAGCAGGTTATCCTAAAGCAACGCAATGACATGCATAAGTCTGAACTCGAGCGTGATCGTCTAG
CAATGGAACTTGAAGACGAAAGGAGGTTAAGGGAGATATTAGAGCACCGGTTGGCCGAGCAAAAGATGTCACAGAACCACAACAATACTGACATATCAGT
AGAGCAATTTGCTGATTCTAGCCAGCTAGACGTATTAAAAACTCCAGATTCTCAGCGGACACAGGATGGATTCATTGCTAGCCGCTCACACTATTTGAA
page-top