Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd10b18
Contig Information
Length 679 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd10b18   
Homology (BLAST) Top Hit hypothetical protein OsI_24914 [Oryza sativa Indica Group]
Score 1070
Evalue 6.08896e-115
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whrd10b18
CGCGCACGGCGGCGGCGGCGGGAGGACGCGGGTGGGGAGGTACGAGCTGGGGAGGACGCTCGGGGAAGGGACGTTCGCCAAGGTCAAGTTCGCCAGGAAC
GTCGAGACCGGCGAGAATGTCGCCATCAAGATCCTCGACAAGGACAAGGTCCTCAAGCACAAGATGATCGCGCAGATAAAGCGCGAGATCTCCACCATGA
AGCTCATCAGGCACCCCAACGTCATCCGCATGTACGAGGTGATGGCCAGCAGGACAAAGATATACATAGTCATGGAGCTTGTCACAGGTGGCGAACTTTT
CGACAAAATCGCTTCGCGTGGGAGGCTCAAAGAGGACGACGCCAGGAAATATTTCCAGCAGCTCATCAACGCTGTCGACTACTGTCATAGCAGAGGCGTC
TATCACCGTGATCTCAAGCCTGAAAATCTTCTGCTTGATGCTAACGGTACTCTCAAGGTGTCTGATTTTGGACTCAGCGCCCTATCGCAGCAAGTCAGAG
AGGATGGGCTGTTGCATACGACTTGTGGAACTCCCAATTATGTTGCTCCCGAGGTTATAAACAACAAAGGTTATGATGGAGCCAAGGCTGATCTGTGGTC
ATGTGGGGTGATTCTCTTTGTCCTCATGGCAGGCTACCTTCCGTTCGAAGATTCAAATCTCATGGCGCTTTACAAGAAG
page-top