Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whrd10b12
Contig Information
Length 762 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
whrd10b12   
Homology (BLAST) Top Hit RecName: Full=Eukaryotic initiation factor iso-4F subunit p82-34; Short=eIF-(iso)4F p82-34 >gi|452440|gb|AAA16209.1| initiation factor (iso)4f p82 subunit
Score 1070
Evalue 7.60298e-115
Total Hit Count 413
Registered year 2003
Contig Sequence     [ Download ]
>whrd10b12
CTCAGCAAAAGATGGTTCCTGAGAAGATAGTTCATCACATTGTCAAGGAGCTACTGGGGTCTGATAAAAAGGCTTGCCCTGACGAGGAACACGTCGAAGC
AATTTGCCAGTTCTTCAATACGATTGGTAAACAGCTTGATGAGAACCCAAAGTCTCGCCGAATCAATGATACCTACTTCGTCCAGATTAGGGAGCTAGTA
GCGAACCCTCAGTTGACCCCACGTTCCAAGTTCATGGTCCGGGATTTGATTGATCTCCGTTCTAACAACTGGGTGCCTCGACGTGCTGAGATCAAGGCGA
AGACAATCAGCGAGATCCACACAGAGGCTGAAAAGAACCTTGGATTACGTCCAGGGGCCACAGCGAACATGAGGAATGGCCGTAATGCACCAGGTGGGCC
TCTTTCGCCTGGAGGTTTTTCAGTGAACCGGCCAGGAACAGGAGGTATGATGCCTGGGATGCCTGGATCTAGAAAAATGCCTGGGATGCCTGGGTTAGAT
AATGATAACTGGGAAGTTCAGCGTTCTAGATCAATGCCAAGAGGCGATCCGCTTCGCAACCAGGGTCCGTTGATCAATAAGGTTCCATCTATTAACAAGC
CATCACCCATCAACCCCAGGCTTCTTCCTCAAGGCACTGGAGCACTGATTGGCAAGAGTGCACTCTTGGGCACCGGTGGTCCACCATCCCGCCCTTCCAG
CCTTACGGCTAGCCCCACTCCTTTACCAGCTCAAACTACAGCATCACCAAAAACCATCAAGT
page-top