Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhpc15f12
Contig Information
Length 867 bp
Tissue Anther at meiosis
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhpc15f12   
Homology (BLAST) Top Hit hypothetical protein OsJ_005360 [Oryza sativa (japonica cultivar-group)]
Score 968
Evalue 6.48626e-103
Total Hit Count 174
Registered year 2003
Contig Sequence     [ Download ]
>rwhpc15f12
CATATTTTGTACAGAAAAAGATATTCAACATCCTTTTCTCCGCATGGTAGTTACCGCACGACCACATTTCAGCCAAAATCGGTACAGTACAATCTACTAT
CGCAAATTTAGGTTGGATCATCGCCTCGAAACCAGCAGGTATGTGTGCCAACTTGACTCGCCTATTTCCTAACATATATACAGAAAAATATTCAGCACTC
ATTCGCTGCGCACTGAATTGTACTTCTCGGCAAGTGAAGGAGTGGCCGTTATCTTGCTCATCAGATTCTTCAACTTCATGCTGTAGTCGCTGCCACTTAT
GCGGTTTACAGCAGCAATTGCTCGAAGAGCACTGCGAATCATGTCTTCGTTGCGATCAATCTCCTGCTTCACTGCGTCACTCTTGGGTTTGTGACCGATG
GTTTTCTCAAGAGGTTCAACTAGTGAGTCCAAAACTGCAAGTACAGCAGATGGGCACTTGTCTGCTAGCTTCGAGAGAATCAGATGGCAGGGCATTTTCA
CATCATAATGATCACCTAAGCCAGATAAGAGGAAAGGAACGATGAAGGACGACGGATTCACTTGATCAAGACAGTTATCCAGCAATGTGTCCACACATTC
AAAGGCAGCTTTCCTAAGCTCAAGCCCATCATCAACGACATGCTTGAAAGGCCCTAAATCAACGGTCCTGATCAATTCTTGCTTCACGACAGTCTGGTCA
TACAAAAGAGGCAGTAATTCAGGAAGAAGACCTTTGATCAAACTTGGCTTGTTGTGGGCAGCTGTGCTCAACGCAAGGACAGCTGCACGTCGCACATGCC
TGTCACTATCTTTAATTAACATAAGGAAAGTAGAAATCTCAGAGTACAAGAATTGCATCTATCTTTC
page-top