Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whpc10d17
Contig Information
Length 846 bp
Tissue Anther at meiosis
Clones 1 Clones [Download: CSV  ,  FASTA ]
whpc10d17   
Homology (BLAST) Top Hit Os07g0598900 [Oryza sativa (japonica cultivar-group)] >gi|33354184|dbj|BAC81165.1| putative cobW protein [Oryza sativa Japonica Group] >gi|113611721|dbj|BAF22099.1| Os07g0598900 [Oryza sativa (japonica cultivar-group)] >gi|125600967|gb|EAZ40543.1| hypothetical protein OsJ_024026 [Oryza sativa (japonica cultivar-group)] >gi|215734925|dbj|BAG95647.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1148
Evalue 8.35203e-124
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whpc10d17
AAGGCGAAGCTCTCGAGCTCTCGGCGGCTATGGAGGACGACGACGAGTGCCCTCCCCTCGCCGTCGAGCTCCCTCCGCAGACGACCTCTCCTCTGGTCCC
CGCTTCCGCCCCCGCCTCCGCCTCCGCGCCGGTCGGCGTCACCGTCATCACCGGCTACCTCGGCGCCGGCAAGTCCACGTTAGTCAACTACATTTTGAGT
GGACAACATGGGAAAAGAATAGCGGTAATACTGAATGAGTTCGGAGAGGAAATTGGAGTAGAAAGAGCAATGATCAATGAGGGGCAAGGTGGTGCCATTG
TTGAGGAATGGGTGGAGCTAGCAAATGGATGCGTTTGTTGCACTGTAAAACACAGCCTGGTTCAAGCACTTGAGCAACTTGTGCAGACTAAGGAGAGAAT
GGATCATATATTATTGGAGACAACTGGTTTGGCTGATCCTGCACCACTTGTATCCATTCTCTGGCTGGACGATCAATTGGAGTCATCAATCAGACTAGAC
TCTATCATTACGGTTATTGATGCAAAAAACTTCAGGCGGCAAATTGATGAACACACGAACTCTTCGTCATTTCCTGAAGCATTTCACCAAATCGCATTTG
CGGATGTTGTGATATTAAACAAAATTGATTTAGTAAAAGACAATCTCGAGGATTTGGAAAGGCAAATTCATGATGTCAATGCGCTTGTTACAGTGGTGCG
GTCTGTGCGGTGCCAGGTTGACTTAAATACAATATTTGATCGACAGGCATATGGTGTGAAGAATTCATCACAACTACAGGAGCTTCTGGAGTACAGTAAA
TCAGCACCACCTAATAGTCGCCATGATAACAGTATTTCCACTTTGT
page-top