Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whpc10f20
Contig Information
Length 797 bp
Tissue Anther at meiosis
Clones 1 Clones [Download: CSV  ,  FASTA ]
whpc10f20   
Homology (BLAST) Top Hit hypothetical protein OsJ_019219 [Oryza sativa (japonica cultivar-group)]
Score 130
Evalue 8.34217e-06
Total Hit Count 21
Registered year 2003
Contig Sequence     [ Download ]
>whpc10f20
ATGTGAATGTGACCGTGGAAGGCTGCTCCTACAGATCGGCCACAGCTTCCACCCTGTGAGGACACTGAGCAGGCAGTGCGTATTGAGGCCCCACCATCGC
CAAACCACTTTCCACCTGTTTCGGCATTGATGCCAAGAGGATTACTAATTAAGTATTTTCTGAGGGTTGATGCTGGTGGACTCTTCCACACATATCCTCA
TCGAGGTGGTCCGTTTAAGAGCTTACAAGAAGCTCAGGATGCTATATACTCCTATCACATTAATCTGTGTAAATTCAAGTAAATCCTCTCTCAACTTTGT
TTCTATTTATAAGTGTTGGAAAATGCTCATATTTATATGCTATGTCCTATGCTAGCACCTTATATGCAAGTATATTTCTCTTTAGCTCACTCCTAACTTA
TAGTTAGGCCACTATTAGCTTGGAACACCCGAGGGTGATAGGTCGAAGTTTTAATGAAGTGGACAGAATAGTCTTGTGACAAAAGATCAATTTCTTAAAG
TCGGTGTATCTAAAGATCAATCATCCAAGCTTGTACTTTTTCTCAGCTATGTGACTGTGTCTTCAGATTCCTGCCCCAGTGTTGTCTTGCAGGTCGGGAC
TTAATGGCCTCTTGTTGGTGATCACTGTGGACCATTGCTGCTGTGATATAAGAGCAAACCGTTGAGATCTCCTTCGGTTTACAGGAATTTTGTACGAATT
CTAAAAGAGAGGAATTTTGTAGGAAAATTACTTTGAGGCCCTTTGGTTTGTTGGAATGAATTTCCTATTCCTATGTAGGCTAGGAATCAATCCTTCA
page-top