Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok10f22
Contig Information
Length 836 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok10f22   
Homology (BLAST) Top Hit hypothetical protein OsI_00169 [Oryza sativa Indica Group]
Score 120
Evalue 0.000130711
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>rwhok10f22
TTTTTGTCAAAATAACAAACAGCAACAAGTCATGGTACTATTGAGTACTTTCTCTCAAAAGCTCAAAATTAACACTGACTTCGAAATGGTGCAAAGGTGC
AAAGGAAGAAAACCTAAAGAAGAGTCCATGCTTAGGAACAAAATCTGGTGCGCGGCAGACAAATTCAAGCAACTGCAAAAATCTCAACCTGCTGGCAGGG
CACAGCGCATGCATTTCAGGGCAGGCAGCTTCAGTTCTTCCTCCAGCCGGTCGACGAAGAAGAAGCCGATGAAGAATTTGCAGAGGGCCTAGATCCACCA
CCAGGACGCCAGCGGTCAGTAGTAGAACCAGCTGGAGGAGCACCATCTGGCTGGCGGGCTGGGGGCGCTTCTTGGCGCGCGGGAGGAACATCTTGGCGGA
GGGGACGGCGGCTCCAGCGGTCTGCTTCCTGGAGCGGGAGCGCATCCTGGCAGAGGGGGCGCACTTCCCGTGCATGAGGAGCCTCTTGGCGAGCATCCCA
ACGGTCTGCTGCTTCAGGTGCAACAGCCGTCCTCTGGCTGCTACCCTCACCGCCACGTCTGTGCCGCGGGACAAACTTGTTAGAACCAGGAGCGGCGGCT
GGTGGTGCGATGGTGGCAGTAGGCCGCGCATCAGGTGGGTCCGCTGCTCTTAGGAGAGCCTCCCTTCTCTCTTTTTCCTTCTTCTCTTCCACCTCCCTTT
CCTTCTCCCTCTGAATTGCTGCAATGGCGTCAAGCTTGAGTTTCGTCTCCGCTTCCTCCCTCTTCTTCCTCTCTTCCTCTTCATGTTTTCTAGCCTCCTC
TTCCTCGCGCACCCTTTGAATCCGTTGTTCCTCCAT
page-top