Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok10f04
Contig Information
Length 882 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok10f04   
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 158
Evalue 5.59664e-09
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>rwhok10f04
ATAATTGCTTGATACAGTATATGTATATGTAGCACTATATGTTTGTTACTGAATGTTGTTGGTCCAGAGTCCAGACATATGGGGAAGGCTGCTAGAGAAT
TTACATGTTGGAAAACTTCAGCAGAGGTCGGCCAGAAGTTCAGCAATGGATGCTGAATATAAGTAAGAGCAGGAAAAGTGAGGTTTGATCATGACCGGAA
TACCGAAACCGTACTGCGGGTGAAGAAGCTGTAGAAATCCTACAGAATCTACTCTCTCTTTCCCCTGTGCTGTGCCTGTGTATCATCTCTCTTCTTCACA
ACCATATACCACTATCCACTTTGATCTGAAACACGGACCATCTGGCAAGAGCCGTATCAGTCCTCCTCGTCATCGGGGGCCCAGGAACGAGGCAAAGGAC
TTGCGAAGCTTGATGATGGATCTGTCACCCTACCCTGCTTCAACTTCTTCGGAGACTCGTCTGCATCTGCTAGCCTCTCTGAAACTCTTTTCTCAACATC
AGAAATACTAGTCATTTCCTTATACCTTTGCAGTTCATACTGAACTATCAGCTTCTCCTTTTCAACTTCAAACTTTGAGAAAAAAATCTGCAGAACACGA
CGTGTGGACAAGTAAGTAATCGACAATAGAGATCATTCATTATGTGGCAAGAAACTACAAATTCAGGTCTCATTATGCACAAGTATAACATGAAGATATT
GGCTCATCCTTTCAAACAAATGATAAATAATTAAGTGTATTTAATAGCCAGTAGCACGATTTCTCATAAACTGCACACACAGTTTGACCAGCTTAAAAGG
TTAACAAAGACATGGTTTTCTTTGGATAACTTTTGGCAATAATTCTCCTACATGTGTCAGGGGAAACNATAATAAACTCNTT
page-top