Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok10d23
Contig Information
Length 796 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok10d23   
Homology (BLAST) Top Hit putative asparate aminotransferase [Hordeum vulgare]
Score 1153
Evalue 1.9845e-124
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhok10d23
CGTCGCCAGAAAAGTGTTACATGCATCGCACCGCGAATGCGGATCAGATCAGGCAGGCCTTTATTCAAACAATCAATCAACAGCTACACGAAACCGCCCC
CCCAATCACTTCTTCCTGAGCTTGGCCTTCATCCGGTCCACCGCGGCCCTCAGCGTGTCGTCGTCCTTGCAGAAGGTGAACCTCACCAGGTTCTTCCCGT
CCTCGGGGTTCAGGTAGAACACGCTCGGCGGGATGGCCACCACGCCCACCTCGCGGATCAAGTACTCGCAGAACTCGATGTCGTTGTCGAACCCGAACGG
GGTGTGGTCGACCATCACGAAGTAGGTTCCGCTTGACGGGTAGACGATGAAGCCCGCGGCCTTGAGCCCGTCGACCAGCAGCGCTTTCTTTGCGCCGTAG
TCCCGCTTCAGCTCCTCGAAGTAGCTGTCTGGTGCTCTCAGAGCTGCCGCCGCTGCTGATTGCATCGGCGTGGAGGTGGCGAATGTGAGGAAGGAGTGTG
CCTGCCTCACGCCCCATGTCAGGTGCGGCGGCGCTATCGCCCAGCCGATCTTCCATCCGGTCAAGGAGAACGTCTTCCCCAGAGAGTTCATGGTGACGGT
CCTCTCATACATGCCAGGAATAGAGGCCATTGATATATGATCCGCCTCAAATGCCAGCTTGTCATAGACCTCATCAGCAAAGAGCAACACGTCATTTTCC
TTGCANAGATCAGCAATGAATTCAAGTTCCTCCCTTGTAAACATTTTCCCAGTAGGGTTGTGAGGTGTATTGATCATTATTGCTCTGGTGTTCTTC
page-top