Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok10d09
Contig Information
Length 445 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok10d09   
Homology (BLAST) Top Hit ribosomal Pr 117 [Triticum aestivum]
Score 487
Evalue 1.0235e-47
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhok10d09
GAGGTTGAGCCTCATTCGGATAGATATCTGGCAAACAAATAATTCAGGTACATTNATCATCCAGGACAAATCTGAAACTANGGAAACATATCATTATCCC
AATCAAGCTCCTCAGACAATGGCATTTGCTGCGCTAGCGATCCTANGCCAGAGGNCANCACACTCCTTACCAATGGGTCCTGNGANAGCAGATCCTTTCA
TCTCACCCTTAGGATTCACAATCACCCCAGCATTATCTTCGAAGTACATGAAGACACCGTCCTTTCGGCGCCATGGCTTGCGCTGGCGCACGATGACCGC
CGGCATGACCTTCTTCCTGAGGTCGGGCTTCCCCTTCTTGACGGTGGCCATGACCATGTCNCCGACGCAGGCCGACGGCANGCGGTNGAGCCTTCCCTTG
ATGCCCTTCACGGAGATGATGNACAGGTTCTTGGCGCCCGTGTTG
page-top