Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok10b10
Contig Information
Length 872 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok10b10   
Homology (BLAST) Top Hit hypothetical protein OsI_16992 [Oryza sativa Indica Group]
Score 135
Evalue 2.55069e-06
Total Hit Count 59
Registered year 2003
Contig Sequence     [ Download ]
>rwhok10b10
TTATGAGGTAGCAACAGACCACAGCCTACGACCATTACAAGTTCACCCATGCTTCCAACTGTGCCATATTTAAACCATCACACCCCGACTCTAATAGATA
TAAAAAGCACAGAAGGCTATCAGCGAATTAACTACTTATAAAATAGATAAATGCAGGGACACGTTAAAGACAAGATATAGATGCCTGGAGCTGAAGGTAA
TTAACCACAACAATCGAAGCAAGAGCTACACTGTTGAAAGCGCCACGAGTTGAGCTGCTCTTCTTTTTTTCCATCTATATCAGACGATTCTTCTTTTCCT
TGTGCAGAAGACCATCAGACAATCCAGTGTGGCTCGCACAGAACTTGACAGCAAGCAGGGTAGGTATGTCAGGATGGAAATCTTTGGAAGGCTCGACTCT
CCACGGCGGTGGCGCTGGTAAGCCATCTTTGATCGGACGATGGCTGCAGGACAGGAGAGACTTTGTGCGCATGTTGATGCTGATCACACACTCAATCTCC
CTGCATAGCCGAGCCCCTCCCTCCCAATCGATGTAGTAATCTCCCAGCAAGAGGTAGAGGACACCATCCTCGTCGGCCTTGAGGACTGGGCACTGCGGCA
TGGCCTGCGGCAGCCTCTCACGCTTGTAGGCCTCCGACTGCCAGAGCAGCGGCAAGGGCAGCTCCATGTCTTCATCTCTCGTCCATGAGTGAAGGTCTGG
CGACAGAGTCCAGCTCCGCAGCACAACGTCAGCAGGGGGCGTGTTGTCACGGGGGTTGTCGCCACTGATGGTGACAATGGAGATGAGCTTTATGGAGTCC
CCGACAGGGCCCATGGTCCGACGATCCTTGGGGTAACTGCGGGGAGAAGTCNCGGCCTTGGCACTCCTCGGG
page-top