Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok10b01
Contig Information
Length 859 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok10b01   
Homology (BLAST) Top Hit sucrose-6F-phosphate phosphohydrolase SPP3 [Triticum aestivum]
Score 1175
Evalue 6.38841e-127
Total Hit Count 88
Registered year 2003
Contig Sequence     [ Download ]
>rwhok10b01
AGCCTCTCATGACATGACAGCTAAGCATTAGGCAAAGGCATCAAGATGCCTCCGTAAACATCATCATCAGTCCAGTATATGCGTCTGGGAGCACTTATTA
ACAACATTATGAACAAGTAAAAGAAATTCGCGTGCTTTCGGTACACGATTTCTTATTTGATCCTCAACAAGAAAACCTCCTTCCCATGCGCCTCCAGTCT
AGAGTTTGGATGACTGCTCGACCCCGGGATATTCTTTACGCCACGTCTTGTGAATGTGTGTTACCACAAAACCCCCAGGGGATTCAGGCTTTACATTCAG
CGCAAGAGTTGTAAAACAGCACACCCACGCAGCACCTTCTGCCTCCCACAAGTCGAATCTCACAAGCCAACTGTCAGAAGCAGTCTGCAAGATAACTAGT
CTGTCCACCCATGATCGGTACTTTTTCCCTTGTTTGTCACCATAACATGAAGCCAGCTCATCAATGGATGAATGGATCGAAAGTTCGACCCCAGACGGAT
GAATAATAACTCCATTTGCATCTGTGATGTTTTTGAAGTACTGTATAACTGAATCAGCCTTTGGAACATCAGCTCTACGCCACTTTTCGTACAGAACATA
GAACTTCACAATGGCCACTGTAGGCTTGAAAGGGTCCTCCTTGATGTAAGGAAACTCAACGTCTCTTGGAGAAACATTAGGTCCTAGCTTGAAGTGCCCA
ATAGCTTGAATAATACCAGCAGCACACCTCTCAGTTGCATGAATTATCTTAGGATTATCCTTCGCATTTTCTGCATGCCACTGGAGTAGTTCCTCTTGGG
CATTGCTAACCATGACACCATGTACACCAGGGATACTGAATAATTCTGCATCATTACCA
page-top