Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok18g17
Contig Information
Length 787 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok18g17   
Homology (BLAST) Top Hit hypothetical protein OsI_22102 [Oryza sativa Indica Group]
Score 1110
Evalue 1.87878e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhok18g17
AACACGACACTTGTTACAACAAAGGCTATATGAGGGACAGGTTACAAATATACATCCAGCTCAAGCCGCCAGTTTGGCCAAAATCACCATATCTAAGATC
TTGACCTCATAGGTGTCGTCGAGCTTCACAATGCCATCAGAACCGTCTATTCCTATAAGTTTTCCAACAAATCCGCGGAAGGTACCATTCATGATCTTGA
TCCTGTCACTCTTCTTTGGTCTGATGACCTCGAGCTCAGTCGGAAGGACCGTCACAATGTCTCCGTTGCCTGACGACCCAAGTGCCACACGGCAAGTTCC
ATCCCCAAGCACTTCCCTGACCACACCAGGTCCTTCATCACCTGCCGCCAAGACATTAACTAACACATCTGGCAATGCCCAGTTAACTTCGCCCTCGCCA
CCTATTACAGGAGACATTATATCCATTCCAGCATTGCCTGGAGTCATTGGTTGACCACCAGGTGTACCAGGAAGGTACGCAGCAGAATTTGGTGTCATTG
GCTGGCCAACAGGTGTGGAAGGCACATATGGGCTTGGAGCATTCGCATAGTTGCCCTCTCTAGGAGTTGGGACGTCATTATAACTAACTCCTGGAGTATT
TGCCCACCCTGATCCAGGTGTTGGGGCTTCATATGGCCGAGCTGGTGGTGTTCCTGGCTGGTAAGCTGGACTGCTTCCCCAAGTATCAGGATTTCCATCT
TCCCAATTATCTCTTGGAGGACTCATAGGAGCCCAGGCCCTACTACGCATCGGGGTCCGCATTCCATCATGTATCGGTGTTGCTCCA
page-top