Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok19g06
Contig Information
Length 773 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok19g06   
Homology (BLAST) Top Hit Os03g0861100 [Oryza sativa (japonica cultivar-group)] >gi|108712232|gb|ABG00027.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113550449|dbj|BAF13892.1| Os03g0861100 [Oryza sativa (japonica cultivar-group)] >gi|215713592|dbj|BAG94729.1| unnamed protein product [Oryza sativa Japonica Group]
Score 522
Evalue 2.75005e-51
Total Hit Count 217
Registered year 2003
Contig Sequence     [ Download ]
>rwhok19g06
GTACTAGAAAATCAACAAACTAATAATCTCAATCGATACCCAATCAAGCTGTTGGCCGGCCTCATCAACAACAACAACAACAAAAATAGTACAAGAAAGT
CCTCACACCGCATCACAGCACGACCACCTTGTTCTTGCGGAACGGCGCCAGCAGGGAGAAGGACCGAGAAGCTTTGTATGAAGAGCCCGCGGAGTCGTCT
TGCGAAATGAGGTTTTTCAGCATCGAACCATCTCCTGCAGGGGCTTCGTCGACGGATGATGCATCGGAATCCATTGTTGAAGTGTGGCTCTTCTTGCCGA
ATTTCAGCAGTTTCCTCAAGCCTTTCGGTTCTTTGCTCCGAGGCTTGTCGCTTCCTCCATGTGTCTCCTCGGCTGAGACTGCGTATGCAGCAGGCTCCGG
CACGCGAGCCCTCACGCTCGCTGCACGCGCAAGTGTCTCGGGTTCCTGCGCAGGTAATGGGTGGTGGTTGTAAGCAGTAGTCTTGCTTGAAGCATCCTCC
AATGATGTTACCCTGGCAAAAGGGGCCTCATAAGGTTTCTCCTCCATCAGAGCCAACGGGGCTGGTTTCTCAAGCTCGTCCTTCTTGTACTCAGGCACAT
CCACCTCATACGAATTCAACTGGTTGTCTGATGTATGGATTGTAGGATTTGCATCTTCAGGAAGATCAATAGGAGAAGGTGGAGCCCTGATGGCAATATA
CTCCTGTTCCAGACTGGGATTCTCCATTCGGTCATCGCTGCGAGTTTCGCTCTCTGCACTTCTTCCANAAGGT
page-top