Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20d08
Contig Information
Length 152 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20d08   
Homology (BLAST) Top Hit 60S ribosomal protein L7a [Zea mays]
Score 90
Evalue 0.111444
Total Hit Count 27
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20d08
ATACTTAACAACTATTGGCTTCTTGGCCTCAANANTCTTCCCTTCATCTTCATCCTGGGCCCTCTTTAGAAGCCTCTCCTTCTTGGCAGCTTTGNCTTCA
GGCCGGTACTTAATAAGCATCTTGAACCAGTTTGTTGCAAGGTTCTTGTCGA
page-top