Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok18d24
Contig Information
Length 796 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok18d24   
Homology (BLAST) Top Hit hypothetical protein mhp533 [Mycoplasma hyopneumoniae 232] >gi|53987412|gb|AAV27613.1| conserved hypothetical protein [Mycoplasma hyopneumoniae 232]
Score 80
Evalue 5.23734
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whok18d24
GGGTATTTCTCCCTCTAGATCTGGCGTGTAGGCCATCAGAGAGACGATAGCAGGGATTGCTGCCATGGCCAAGTCCTAAACTTCCAACGAGAGTCTCTTT
CTTCCGTGCTGCAAATGGAGGCTACTAGCGACAGGACCGCCATGGGTAGGCCTGGGAATTACAGGCGTGGAGGATTTCTGGGCAAGCCACTCGTTCCTGG
GCGTGCCTGTGCCACTGCCGATGTGGATTTAGCCTTGCTGAAATTACTGAGCTCTATCCCCCAGGTAATTAGAGCAGCATGACCAACCATTGCCAAATTC
CTTCCTAAGTGGAGAAGTTCCCAATCCCTAAGATCAAGGAATGAAGATAAGCTTTTCCACTTTGTTGTATCAAGTAATTTAACTTCCCAGTTCACTCTAA
ATTATTGTGTATTGGCAACCTGAATTATCTATTTTACAAAAAAGCATATATACACTTCTGTAGTTCTATGAGATCAATGGAGCAAGAAGGGCATGCAGTA
TTGTCTTCTGTCGCTTGGAAATACTAATTGAAAAAAGATATGCAGCATTAGTAATATCCTTCTCATATGTGGTCCGAGACTCCGAGGGAGACGCCCAGTA
ATGAGTGTAGTGGTCCTTGTAGATAGGTTTTTCATGACTTCAACATGCGCCTTCCATCTCATTACTATGTGTTACCCCAAAATCCTATGAGTTCATATAC
GAGTTTTTAATCTCTGCAAGTAAATTTTGATATTGTGTAAGGTCTGTATGATTANAATCCCATGGGAAACTGTGTAATCTCTTGTAAGACAATATG
page-top