Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20e06
Contig Information
Length 897 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20e06   
Homology (BLAST) Top Hit hypothetical protein OsI_08032 [Oryza sativa Indica Group]
Score 959
Evalue 7.5878e-102
Total Hit Count 331
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20e06
CAGCCAGAGACAGGCATTTCCATACATTCGCTCACACTGGCAGAAAACGCTAACCATTTTCACGTCACTTGTCCATAACAAAAGTAATAGGACAGGAACA
GGAAATCTCTAAGAACAAACTGACGCAACACAAGCTCGTTCAGACCAGCTAGCATCACCATCAGCAGCTCTTCATCCTCTTAACAGCCCCCCTCTCATCC
TTCTCCTGCGCAGCATCGTCTTCCCAGCAAAGGAAAGCATCCATCTTGGAGCCGCTCTCTAAATTGCCATGAACGTTGCAGTTCAGGACAGATCTTGGTG
ACCCGGTGGAGTCTTCGCCGACAGCAGTGAAGCTCTGGTAGATGAGAGCGCCCCCGTCAGGCAGCTCCTGGACGACCATGTTGGTACTATCATAGACCCC
AACATTCAGCCTCTCCCCCCAGGTGCCAGCAAGGTTGCGACCGCCAAAGATGGTCACAGCAACAGAGAATTCAGACGGGCCAAAGGATCTCAGCACCCTC
TTGACCAGGTCACCATAGGCCATGGAGGCAGGGTCCAACCCCATGACCTCATAGCTAGCATAGCTGAAGCCGTCCTCAGGAGTGACATGAATGGTGGAGA
AAGCAGAGCCATGGATGGCGTTCATGGAGTAGCCACATGGCTCGAAATCAAAGTCACAGATCTCCATCTCCGGGATTATTTCAGAGATGCCAGAGAGCTT
GGTCATCTCCTTGGCACAAGATGTGTAGCCATCAGCAGAGGTCTTGAAGAAGACAGAAGCTTTCTTCTTGTCCAGACCAGTCATGCACATCTCAAGGTTG
ACCATGGGCTGCTCAGGCTGCTGGGTGGCATAGTAGACATGCCACTTCTGGCCTGGCTTTGCAGGATCACCNAATGACATAGGCATTGCCGCCANAC
page-top