Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok18e04
Contig Information
Length 804 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok18e04   
Homology (BLAST) Top Hit putative mechanosensitive ion channel protein [Oryza sativa (japonica cultivar-group)]
Score 1082
Evalue 6.97899e-129
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok18e04
CTCCTTTGGACAGGGGCAACACTTATCTGCAGGGGTTTGGATCCAGTCGTGTTGCCTTCAGCAGCAAGCCAAGCTGTTAAAACACGCCTTTTGACATTTG
TGAGATCCTTATCGACCGTCCTGGCTACTGCATATATTATGACAAGCTTGATTCAGCAGGTACAGAAATTTCTAGTGGACATACGAAGCCCCAGTGATAC
ACGAGCTATGGGGTTGGATTTTACCATGAGAGCTGTTTATACTGGTATCTGGATTGCTGCTGTTTCTCTCTTTATGGAGTTGCTGGGTTTCAATACCCAG
AAGTGGATAACTGCTGGAGGTTTTGGGACAGTATTGCTTACGCTTGCTGGTCGTGAGATTTTTACGAATTTCCTCTCAAGTGTTATGATCAATGCCACCC
GCCCATTTGTAGTGAGTGAATGGATCAATGCAAAGATAGATGGTGTTGAGGTATCTGGTATTGTTGAGCATGTCGGCTTGTGGTCACCAACAATCATTCG
AGGCGATGACAGAGAAGCTATATACATCCCTAATCATAAGTTCACAATGTCTATATTGAGGAATAACACGCGGAGAAACCATTGGCGTATTAAGACATAT
CTTGCTATAAGCCACATGGATGCTGGAAAAATTGGTATAATTGTTGCAGACATGAGGAAAGTGTTGGCCAAGAATCATCATATANAACAACANAAGCTGC
ATAGGAAGAGTATTCTTTGAAAAAATTGATCCAAAAACTCAAGCTCTTATGATATACATATCCTGCTTTGTGAANACATCGCATTTTGAANAGTATCTAA
ATGT
page-top