Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok19l21
Contig Information
Length 672 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok19l21   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195625540|gb|ACG34600.1| bifunctional polymyxin resistance arnA protein [Zea mays]
Score 511
Evalue 3.93689e-50
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok19l21
AATCTCCTCCGTAGAGAGCCCCTGAAGCTTGTCGATGGCGGCGAGTCCCANAGAACTTTTGTTTACATCAAGGATGCCATTGAAGCTGTTCTTCTGATGA
TTGAAAACCCTGCTCGAGCCAATGGTCATATCTTCAACGTTGGGAACCCCGACAATGAAGTCACTGTTANGGAGTTGGCCGAAATGATGACANAGGTCTA
CGCTAAGGTCTCNNGAGAGCCCCCGCTGGAGGAGCCTGTGGTCGACGTGAGCGCGAAAGAATTCTACGGCGAAGGGTACGACGACAGCGACAATAGGATC
CCTGACATGACCCTGATCAACAAGCANCTANGGTGGAACCCCAAGACCCCTCTCNAGGACCTGCTGGAGACGACGCTGACCTACCANCACAAGACCTACA
AGGAGGCTGTGAAGACGCAGATGTGTCTGGCCACNGCGACGCCTTCAAGCTAGACGATGACGGCGCGGCCATGCTGCTCTTGATCTTTTGGAAGCCAGAT
ACTTATATCGTANTGAAACCGTCGTCGTCGTTTTTGTCGCGCCTCTAGATCACACCCACCCATCTTCTTACCTACCTAGATTCGTCATTGTGTAACCCTA
TATTGGGCAAAGGGAACTGAGTATCTATTATACCTGTGGTGGCAGTGTTTGTTATGTTTGGTTGGTTGCACC
page-top