Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok18e20
Contig Information
Length 822 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok18e20   
Homology (BLAST) Top Hit Os03g0267800 [Oryza sativa (japonica cultivar-group)] >gi|108707367|gb|ABF95162.1| LIM domain-containing protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548139|dbj|BAF11582.1| Os03g0267800 [Oryza sativa (japonica cultivar-group)]
Score 1248
Evalue 5.90047e-137
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok18e20
AGTGGCTCTGCAATTTCCTCAAGGGGACGAAGCCCGTGGAGTCAAACCACCGGCGGCGGCCTCGGGTGACCGCGGGAGAAGAGAGCTCGCTCTGGCAACA
AGAACCAGTCAGGCCAAAGAGGGAGGATCCACCTAGACATGACAATGAAGAATTGGACCGTCAGATTGCACTCTCTCTTGCAGAGGAAGCCAAACGTCCT
AAAGAGCGAAACCATAACAAGGGAGAGAACGATGAAGACCTCGCCCAGGCCATGCAGGACAGTCTGAACATGAATCCTTACATGCCACACAATCCATATG
CCCCCTCCCAGGCCTTGCCTAGAGGGCAAAGGGTCTGTGGTGGCTGCAAGCATGAGGTAGGACATGGCCATTACTTGAGCTGCATGGGAATGTACTGGCA
TCCTCACTGCTTCCGTTGCTCTTCCTGCACTCACCCTATCCGCGAGACCGAGTTCACCTTGCTAGGCGCAGAGCCATACCACAAGTTGTGCTACAAGGAG
CTACACCACCCGAAATGTGATGTCTGCCTTCAATTTATCGCAACGAACAGGACGGGCTTGATAGAGTACAGAGCCCATCCATTCTGGGGCCAGAAGTATT
GCCCCTCACATGAGCTTGACCGCACACCTCGTTGCTGTAGCTGTGAGAAAATGGAGCCAAGGAACACGAAGTATATGTCGCTGGGAGACGGGCGCAGTTT
GTGCATGGAATGCCTGGATTCTGCGGTCATGGACACGGGTGAATGCCAACCCCTGTACCACTCCATCAGGGACTACTACNAAGGATGAACATGAAACTCG
ACCAGCAGATACCCATGCTCCT
page-top