Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok19l13
Contig Information
Length 743 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok19l13   
Homology (BLAST) Top Hit hypothetical protein AN1130.2 [Aspergillus nidulans FGSC A4] >gi|40747092|gb|EAA66248.1| hypothetical protein AN1130.2 [Aspergillus nidulans FGSC A4]
Score 80
Evalue 4.58942
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>whok19l13
GCTTCTTCTCACAAAAGTCTTCCGCATCTCCACCTTCCTCCGGCGATCTCTTGCCCAGCCACGGCGGAGATGGTGCCCAAGCGTGTATTCATGGCCATGT
GACATGGGGAAAGAGAAGGCGGTCGCCGTGAAGGAACCGAGGCTTAGGCCGTGCATGTGCCCATGAGACTACAGCGCATATGCGAGGGGGCTGATTCCTT
AGGCGTCCATGGCATGAACCTTGGTTTATGCTTCAAGATCTAAAGCAATCATGACGTCGGTATGAACATAAATCGCCCAACTTAAATGAGATTCGCCCTG
ACGGAGCTTTGAATTAACTCTTTCCTGATGAACTCCGGCGAGCTCTTTTGCATGAAGCCGACGTGGCCGTGAGGATGTCCGTGAGCCGTGCATCTTCCTC
TCGGAATTCCTCTCCTCCTCTGGAAAGTCCTGCCCAACTCCACATAGCTTCCTCCGGTGAGCTCTTGCTCAGCCACGGCCGAGGCGACCGGGATGAAAGT
CCCAAGGCATATGCTTGACGTTCATGTGACATGGAGAATGAGAGGCTGTGCCGGACTATGTATGTTGGTTGTCCTCTGCACCTCTTTCTTCTAGTGAATC
CCCGGCGAGTCCTGTTCATGCCCGGCGAGGTGGCTGAGATGGTGTCCGAGGCATAGGCCCGTGCATGTGCCTCTGGGACTACGGCGCGCAAGTCACGAGG
CTGAATCCTCAAGTGTTCATGGGACGAACCANAGTTTATGGAG
page-top