Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok19k23
Contig Information
Length 727 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok19k23   
Homology (BLAST) Top Hit hypothetical protein OsI_04777 [Oryza sativa Indica Group]
Score 923
Evalue 7.78371e-98
Total Hit Count 132
Registered year 2003
Contig Sequence     [ Download ]
>whok19k23
TGATGATGCTTTGGTTGCAGTTGTAATCCGCAACTTGAAGTTAGTTAAGGGTGATTCAAAGGTCGTCATTATGGATGCTAATGGAACCCGATCAAAGTCC
ATTGCTAGGCTACTGAAGAAGCTCGGTGTGCAGCAACCTTACCTGGTTAAAGGTGGTTTCCAATCTTGGGCAAAGAATCTTCGCGTGAAAGAACTGAAAC
CTGAGACTGCATTGACAGTAATAAATGAGGATGCTGAGGAAATCCTCGAAGGCATAAAGCCCACCCCTACACTTGTCTTTGGATCACTTCTGGGCCTCTC
AGCAGCTACTTTTGCTTTGCTAGAATGGGAGACGACTTTGCAGTACATCGGTGTTCTTAGTCTTGGGTTGACGATCTACCTGCGGTTCTCTTCATACGAG
GGTTCGGAGGATTTCCTGCAAGACCTAAAGCTGTTGCTGTCCCCAGTAAGAGTGGGCGCGGAAGCGTTCTCATGGGCAGCTAAGAAGCTAGAGCCTAACA
AGATTGGCCTGGCAACGTCCCCCTCCACAACGGCGGTGCAGGACCGAGTTCTCAAAGCTGCAGCGAAGCACGAATCGAAGCCATCTGATGCGGAGGAGTC
CACCAAGACAGACAGTTTTGCCTCCGAAGCATGAGAAGCTCCCTGTGAGCGTGTGAACTGGATCCGTAGCCACTTCGCCGTCAGTCTGGTGAATTGATGT
TTTTGATGTTANTAATGGGTACCATGA
page-top