Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok10l08
Contig Information
Length 437 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok10l08   
Homology (BLAST) Top Hit hypothetical protein OsI_23746 [Oryza sativa Indica Group]
Score 206
Evalue 3.85221e-15
Total Hit Count 260
Registered year 2003
Contig Sequence     [ Download ]
>whok10l08
GGCCGCCTACATCTGCNGCGCGCACGCCAGGAAGGTGTCCGAAATGGTTTCCGTCGTCAGGAGCCTGCATCCCAACCTGAACTACCCAAACGAGTTCGTT
CAGCTGGTGGGGGATGAGAAGGTGTTCAGCTCCGAGAAGCTGCAGAGGCTGGGGTGGAAGTTCAGGATGTTGGAGGAGACGATGAAGGACAGCGTCGAGT
CCTACATGTCTGCAGGCATACTGAGCTGAGCTTGGCTATGGTGTCATCGAATAAATAATTTTACCCATGCAGGGATGTACCCGTGGGCAATCCACCGTTT
TCGTCAAGATCCGTGAAGGTTTTATACTTTACTAGATGACCAGTTGCGCCATTGGCGCAAAGGCCAAGAGTAAGCCATGTATTGAAAGAGTGTTCATTAA
TATTATTCGGTCATATATTAATATGAGAAAAAAAAAA
page-top