Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok10l07
Contig Information
Length 184 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok10l07   
Homology (BLAST) Top Hit hypothetical protein OsI_36458 [Oryza sativa Indica Group] (no hit)
Score 486
Evalue 4.44996e-47
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whok10l07
ATCCCCACACCCCGCGCTCCTGCCTGCCCGCCTCCGCGCGCCCCTCCCCGCCTGCACCTTCCCCCTCGCTGTCACCAGCACAGATGAGCGGGAGGCAAAT
GAGGAGTTTGTGGTGGCCACATACAAGCTGGTGCCCGTCGACNACCCCCGCGCACAACTCCACTTCTCCCTTGGGCCATTTAGT
page-top