Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok18f11
Contig Information
Length 808 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok18f11   
Homology (BLAST) Top Hit hypothetical protein OsI_36458 [Oryza sativa Indica Group]
Score 486
Evalue 4.44996e-47
Total Hit Count 74
Registered year 2003
Contig Sequence     [ Download ]
>whok18f11
AGCGGCGGCACGCGGCGGCGCAGCTTGTTTCAAGGTCGGCACATCCTGCAGGCCAGTTGAAGTCGGCCTACCACCCCTGGACCAGCCCAAAGCCGAGTCA
CGGCCGCACCGCAACTCGCCAGCTTCCGCGCACCAGCTGCGCCGCCCTCGCCAGGCAGCGATATCTCCTATCTCTCCTGCCGGCGGGTCGGTGGTTCCAG
CGGACAAGATGCTGGGCGTCTCCACCAGCCAGCTTTTGGTCATCCTCGGGGCCTGCTCCGTGATGATGAAGCCCAGTGACATGATCAAGATGGCAAGGGT
GGCAGGGAGGATGACCGGGAGAGCGGTCGGTCGCCTCATGCTCTACCGCCGGCAGATGGACGACATCTTCGAGCAGACTGCAGCGAAGAAGATTAATACG
GAGCTTCAAGATGCCATGTCAAAGTTACAATCAATTGGTTATGAAGTTCAGAACTTATCTAGAATAACTCCTGGCCAGTTTATCAAAAGGCAGCACAACA
CCGAGGGCATGACTGAAGCAGGAACATATGATGGTTCTGCAACTCAGTCTGGAGAATTTCGTGATGATATTCGCAGTATAATTCGTGATGAAATTGAGAG
CTTTTGTAGAAAAAATCCTGATCAATTTACCAGGAGATTAAATAATTCTGACGGAATTCANAACTCTGAAAAACCAGCTGAAGCTACAAAATTTGATGTA
ACTAATAAATTTGCAATGACATCTAAGGACATGGAATCANCGAATGCAAGCTCTACAAATCTGCACAGCCAANCAATGATGTATGCCAGGCTAAGTGTAT
CCCCANGA
page-top