Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20g20
Contig Information
Length 267 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20g20   
Homology (BLAST) Top Hit Os09g0252100 [Oryza sativa (japonica cultivar-group)] >gi|113630918|dbj|BAF24599.1| Os09g0252100 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 193
Evalue 1.26973e-13
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20g20
ACTGGTGCTCATTACTATCATGCAATCTGGTTCAGTAGTATTATATATAGGATCATATATGCAGGTACACTCCGAAAAAGACAAGGTTCCTCGAAATTCT
CGAGCCAATTCTCTCATGAGATTGACAGTCAGAAAGGACTGTGGGTCGACAACTGCACTGTAAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGANANANA
page-top