Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok10k16
Contig Information
Length 406 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok10k16   
Homology (BLAST) Top Hit hypothetical protein OsI_24155 [Oryza sativa Indica Group]
Score 576
Evalue 4.87083e-58
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok10k16
CTCCATTGAACCATGTGCAACTTTGTAGATTGTCTCTAACACGCATTGGGTTTACTGAACGCGTGTTGNGGATTCAAATGCTGGACCTAAGCCATAACAG
CCTCANATCAGTTGAAGGTTTGGAGGCTCTGCANCANCTTGTGTGCCTGAACATCANCAACAACCAGATCAGCAGTTTCACGTCACTCGAACCCCTGACG
AAGATAGTTTCTTTGAAAGCGTTGGATTTGTCTTTCAACAAGATTGGAGCTCACTTGATCGACACGACACGTTACATGTGCTCATCTCCATTTTCGCACA
AAGTCGAACGGTGTGAAGCCTTCGAGGAGTGCCGAAAGAAAAACGTCAATGTGGAGGAGTTCTGGGACGCCATACTCTTCTTCAAATCCATGGACCTGGT
GCAGCT
page-top