Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20h09
Contig Information
Length 819 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20h09   
Homology (BLAST) Top Hit hypothetical protein OsJ_010322 [Oryza sativa (japonica cultivar-group)]
Score 695
Evalue 2.64787e-71
Total Hit Count 340
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20h09
GATTACATTTTTCTGGGTACAAGTTGAAGAAAGCCGCACTTACTAGTTCAAAAATGAGGTGCATGCTGCACTATAAAACACTATACTAATCTTACCAGCA
GAAGAATACCCTTTAATACCGAATGTGGTGGATTTTCCGTAGATGATTGGTTTATGTATCAACTATGGTACAGGGATGCTTTTGCAGCTTGGTGGAGGCA
GCCACACAAATGATTTTCTGTAGATGGTTGTTTTATTATGTATCAACTACGGTAAGAGATGCACAAGCTGCAGCCACACAAATGATACATAGCCATCTGA
GCTTCGGAGATGATCCTATGTGCATTGTACCAAACAAACAGGATCCACTTCCCTCAGCAGAGGCTCGGATAAAATTGGGAAGAACCCTTCAAGGATTCAA
CATCATCAATTGCAGTCCATGACTGCTCTTGCAGCTTGGCAGCCTCAGCAATATCCGAGTTGCAACCATACACATGTATTGCCAATCGTCTACGTGTTGG
AGAAGATGATCTTATGTAGGTATTGTACCAACTGATGACGTCCTCCTTCCCAACTGTCCTTAGCTCTTCAGCTTCCAGTTTTGACATATCAAACATATAC
CTTTTGTCGGTAATCTGCGACCAGTAATCACCAGTTTGATAGCTAAGGGAAGGATCCTTCTCAAGTTTTTGAGCTATTAGCCCACTCTTGTGATGCTCAA
AAGTCTCCTCCTCAAGCCCATCCAGCAAAGCAGACAGACCATCAATAAAGTTATCAATCCTGCTTTGCAGGTAAACAGGGCTATACTTGGAGGACATAAC
CTCGAAAAACAATACGCCA
page-top