Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok10k11
Contig Information
Length 279 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok10k11   
Homology (BLAST) Top Hit Os01g0144000 [Oryza sativa (japonica cultivar-group)] >gi|10798840|dbj|BAB16471.1| unknown protein [Oryza sativa Japonica Group] >gi|13486897|dbj|BAB40126.1| unknown protein [Oryza sativa Japonica Group] >gi|113531532|dbj|BAF03915.1| Os01g0144000 [Oryza sativa (japonica cultivar-group)] >gi|215678815|dbj|BAG95252.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218187500|gb|EEC69927.1| hypothetical protein OsI_00357 [Oryza sativa Indica Group]
Score 76
Evalue 4.55465
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whok10k11
GCTGCTTCCACGGGCAACTACGAACCGGACTGTCAAATCTTCCACCTCAGCTCATAGTATCTTGCCGACCGGGGCAACGTCTATCCATGACACCTTGGAT
CACCGCCACACCGTTTTTGTAAGCAATATCATCCCCCGCCCACTCTGTGCGGAGGAANTGTGTCACACNAANANAGCCANCCCTTCTGCCGTANGTANCT
TGTGTANANANGCTTTACCACCTGTTGCTANAAANATTCTTTCTGGANATTAAATTATGTGTTATTATTANNCAAGGCC
page-top