Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20h15
Contig Information
Length 819 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20h15   
Homology (BLAST) Top Hit hypothetical protein OsI_14427 [Oryza sativa Indica Group]
Score 946
Evalue 2.07866e-100
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20h15
AAATAGTTTTCAACATGGCAATCGCCACGAAGCGTGCCAAACAGACAATAGAACAGGCCATCATTATCCATTACACACCATGATTTCCTCCTTAAGGTGC
CACGGTTCTCTCCCCTGGCAAAACGATCACCACACGCCCCTAAAATTGCATGCCCCCAGGTTGCTACATATCATTGCGCTTCTACATCATGCCCTGGGGC
ATCCCGGCGGGCGCGGGAGCCTTCTTGCTCGGCTTCTCCACGACGATCGCCTGGGTGGTCAGGACCATTCCGGCCACCGACGCTGCGTTCTGCAGGGCGC
ACCTCGTCACCTTCGCTGGGTCAATGACGCCAGCCTCAACCAGGTTCTCGTGCTTGTCGGTCATCGCGTTGTAGCCGAATTCCCACTCGCTGTCCTTGAT
TTTATCCACGATCACCTCCCCTTCGACTCCGGCATTGTGCGCGATCAACGATGCGGGTGCCACTAGAGCCTTCTGAATGATATCAGCACCAAGGCGCTCC
TCAGGGTCATCCAGCTTCTCCTTGATAGCTGGTACGAGAGTCGACAGGTGAACATAGGCCGCACCACCTCCAGGTACTATACCTTCCTCAATGGCTGCAA
AAGTGGCATTCTTGGCATCCTCTATGCGGAGCTTGCGGTCCTCAAGCTCCGTTTCTGTTGCAGCTCCAACCTTGATCACAGCAACTCCGCCAGAGAGCTT
TGCTATTCTCTCCGCCAGCTTCTCANAATCATATGTCGAGTCTGTCTGANAAAGCTCTCTCTTCAGCTGCGCAATTCTAGCCTGGATCTCATCCTTGGTG
GCAACATCTGCTATTATGG
page-top